SubtiBank SubtiBank
cwlK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cwlK

peptidoglycan hydrolytic L,D-endopeptidase
locus
BSU_02810
pI
5.66
mw
18.97 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
cell wall turnover
product
peptidoglycan hydrolytic L,D-endopeptidase
essential
no
synonyms
ycdD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.4|Endopeptidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    303,804 → 304,307

    The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between L-Ala (position 1 in the peptioglycan peptide) and D-Glu (position 2) [Pubmed|18266855]
  • Protein family

  • peptidase M15C family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|17588176]
  • Biological materials

    Mutant

  • BKE02810 (Δ[gene|FCE68CB323C7FDFE09B1F88EAEB95D045A189AEB|cwlK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGGTCTCACTTTCTC, downstream forward: _UP4_GAGATGATTCCTAACTAGAC
  • BKK02810 (Δ[gene|FCE68CB323C7FDFE09B1F88EAEB95D045A189AEB|cwlK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGGTCTCACTTTCTC, downstream forward: _UP4_GAGATGATTCCTAACTAGAC
  • labs

  • [SW|Ciaran Condon], IBPC, Paris, France [http://www.ibpc.fr/UPR9073/condon/index_en.html Homepage]
  • References

    Reviews

  • 18266855
  • Original publications

  • 17588176