SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


repressor of fatty acid synthetic genes
21.26 kDa
protein length
188 aa Sequence Blast
gene length
567 bp Sequence Blast
regulation of fatty acid biosynthesis
transcriptional repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of fatty acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    1,661,967 → 1,662,533

    The protein

    Catalyzed reaction/ biological activity

  • FapR regulates the expression of at least 10 genes (the ''fap'' regulon). It autoregulates its own expression. Malonyl-CoA, a precursor of fatty acid biosynthesis, binds to FapR changing its conformation to a non-DNA binding state. Hence, conditions that cause malonyl-CoA accumulation, like fatty acid biosynthesis inhibition, derepress the ''fap'' regulon.
  • Protein family

  • fapR family (single member, according to UniProt)
  • Effectors of protein activity

  • malonyl-CoA and malonyl-[protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|ACP]]] act as the molecular inducer of the FapR regulon [Pubmed|20201588]
  • Structure

  • [PDB|2F3X] (complex with effector), [PDB|2F41] [Pubmed|16932747]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16932747], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]: repression, [Pubmed|12737802], in [regulon|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • ''[protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]'': repressed in the absence of malonyl-CoA or malonyl-[protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|ACP] ([protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]) [Pubmed|12737802]
  • expression of the operon is strongly reduced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-B138 (ylpC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15880 (Δ[gene|FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAAACACCATCCGG, downstream forward: _UP4_AAACATTCATAAAGGTGGAG
  • BKK15880 (Δ[gene|FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAAACACCATCCGG, downstream forward: _UP4_AAACATTCATAAAGGTGGAG
  • References


  • 17919287,27766255,15802245,18372209
  • The [SW|FapR regulon]

  • 12737802
  • Original publications

  • 18384517,20201588,16932747,31113899