SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


repressor of fatty acid synthetic genes
21.26 kDa
protein length
188 aa Sequence Blast
gene length
567 bp Sequence Blast
regulation of fatty acid biosynthesis
transcriptional repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of fatty acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    1,661,967 → 1,662,533

    The protein

    Catalyzed reaction/ biological activity

  • FapR regulates the expression of at least 10 genes (the ''fap'' regulon). It autoregulates its own expression. Malonyl-CoA, a precursor of fatty acid biosynthesis, binds to FapR changing its conformation to a non-DNA binding state. Hence, conditions that cause malonyl-CoA accumulation, like fatty acid biosynthesis inhibition, derepress the ''fap'' regulon.
  • Protein family

  • fapR family (single member, according to UniProt)
  • Effectors of protein activity

  • malonyl-CoA and malonyl-[protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|ACP]]] act as the molecular inducer of the FapR regulon [Pubmed|20201588]
  • Structure

  • [PDB|2F3X] (complex with effector), [PDB|2F41] [Pubmed|16932747]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16932747], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]: repression, [Pubmed|12737802], in [regulon|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • ''[protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]'': repressed in the absence of malonyl-CoA or malonyl-[protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|ACP] ([protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]) [Pubmed|12737802]
  • expression of the operon is strongly reduced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-B138 (ylpC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15880 (Δ[gene|FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAAACACCATCCGG, downstream forward: _UP4_AAACATTCATAAAGGTGGAG
  • BKK15880 (Δ[gene|FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAAACACCATCCGG, downstream forward: _UP4_AAACATTCATAAAGGTGGAG
  • References


  • 17919287,27766255,15802245,18372209
  • The [SW|FapR regulon]

  • 12737802
  • Original publications

  • 18384517,20201588,16932747,31113899,32671874