SubtiBank SubtiBank
fapR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fapR

repressor of fatty acid synthetic genes
locus
BSU_15880
pI
5.39
mw
21.26 kDa
protein length
188 aa Sequence Blast
gene length
567 bp Sequence Blast
function
regulation of fatty acid biosynthesis
product
transcriptional repressor
essential
no
synonyms
ylpC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.1|Biosynthesis of fatty acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,661,967 → 1,662,533

    The protein

    Catalyzed reaction/ biological activity

  • FapR regulates the expression of at least 10 genes (the ''fap'' regulon). It autoregulates its own expression. Malonyl-CoA, a precursor of fatty acid biosynthesis, binds to FapR changing its conformation to a non-DNA binding state. Hence, conditions that cause malonyl-CoA accumulation, like fatty acid biosynthesis inhibition, derepress the ''fap'' regulon.
  • Protein family

  • fapR family (single member, according to UniProt)
  • Effectors of protein activity

  • malonyl-CoA and malonyl-[protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|ACP]]] act as the molecular inducer of the FapR regulon [Pubmed|20201588]
  • Structure

  • [PDB|2F3X] (complex with effector), [PDB|2F41] [Pubmed|16932747]
  • Expression and Regulation

    Operons

    genes
    [gene|FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR]-[gene|8F5612395EBF90BEF4C80056EECAFC572384E7F8|plsX]-[gene|BB8542A6444564B21FF5DB6E2C75192C6DA2DFB8|fabD]-[gene|439B468A13137000FB42E9389391CB4986FFED84|fabG]-[gene|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|acpA]
    description
    [Pubmed|19850612]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16932747], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]: repression, [Pubmed|12737802], in [regulon|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • ''[protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]'': repressed in the absence of malonyl-CoA or malonyl-[protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|ACP] ([protein|FCDE900167AE36377979E0CF7BC33C7F351B95D3|FapR]) [Pubmed|12737802]
  • expression of the operon is strongly reduced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B138 (ylpC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1137 NBRP B. subtilis, Japan]
  • BKE15880 (Δ[gene|FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAAACACCATCCGG, downstream forward: _UP4_AAACATTCATAAAGGTGGAG
  • BKK15880 (Δ[gene|FCDE900167AE36377979E0CF7BC33C7F351B95D3|fapR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAAACACCATCCGG, downstream forward: _UP4_AAACATTCATAAAGGTGGAG
  • References

    Reviews

  • 17919287,27766255,15802245,18372209
  • The [SW|FapR regulon]

  • 12737802
  • Original publications

  • 18384517,20201588,16932747,31113899