SubtiBank SubtiBank
exoR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

exoR

magnesium-dependent 5'->3' exonuclease, contributes to the removal of RNA from an Okazaki fragment, protection of developing and dormant spores against UV DNA damage
locus
BSU_22010
pI
5.22
mw
32.79 kDa
protein length
296 aa Sequence Blast
gene length
888 bp Sequence Blast
function
removal of RNA from Okazaki fragments
product
5'->3' exonuclease
essential
no
synonyms
ypcP,exoA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,310,995 → 2,311,885

    Phenotypes of a mutant

  • a [gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA] [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] double mutant is not viable (synthetic lethality) [pubmed|17114254]
  • a [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC] [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] double mutant is not viable at 25°C [pubmed|30670546]
  • The protein

    Catalyzed reaction/ biological activity

  • removal of RNA from Okazaki fragments [pubmed|30670546]
  • magnesium-dependent exonuclease, shows highest binding affinity to 5′ overhangs in dsDNA [pubmed|31251806]
  • Paralogous protein(s)

  • [protein|3D6DA8B52A4CB49361E67906140696FFA1EF6099|PolA]:
  • [SW|Domains]

  • 5'-3' exonuclease domain (aa 175-262) (according to UniProt)
  • [SW|Cofactors]

  • Mg2+ [pubmed|31251806]
  • Structure

  • [PDB|1BGX] (Taq polymerase, 36% identity) [pubmed|9770525]
  • [SW|Localization]

  • recruited to replication forks after induction of DNA damage [pubmed|31251806]
  • Expression and Regulation

    Operons

    genes
    [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B868 (exoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1867 NBRP B. subtilis, Japan]
  • BKE22010 (Δ[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAATAACTCCCTTTTC, downstream forward: _UP4_GCTAGAGAGATCGTTTAGAT
  • BKK22010 (Δ[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAATAACTCCCTTTTC, downstream forward: _UP4_GCTAGAGAGATCGTTTAGAT
  • References

  • 17114254,17905985,16045613,30096406,9770525,30670546,31251806