SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


magnesium-dependent 5'->3' exonuclease, contributes to the removal of RNA from an Okazaki fragment, protection of developing and dormant spores against UV DNA damage
32.79 kDa
protein length
296 aa Sequence Blast
gene length
888 bp Sequence Blast
removal of RNA from Okazaki fragments
5'->3' exonuclease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,310,995 → 2,311,885

    Phenotypes of a mutant

  • a [gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA] [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] double mutant is not viable (synthetic lethality) [pubmed|17114254]
  • a [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC] [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] double mutant is not viable at 25°C [pubmed|30670546]
  • The protein

    Catalyzed reaction/ biological activity

  • removal of RNA from Okazaki fragments [pubmed|30670546]
  • magnesium-dependent exonuclease, shows highest binding affinity to 5′ overhangs in dsDNA [pubmed|31251806]
  • Paralogous protein(s)

  • [protein|3D6DA8B52A4CB49361E67906140696FFA1EF6099|PolA]:
  • [SW|Domains]

  • 5'-3' exonuclease domain (aa 175-262) (according to UniProt)
  • [SW|Cofactors]

  • Mg2+ [pubmed|31251806]
  • Structure

  • [PDB|1BGX] (Taq polymerase, 36% identity) [pubmed|9770525]
  • [SW|Localization]

  • recruited to replication forks after induction of DNA damage [pubmed|31251806]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B868 (exoA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22010 (Δ[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAATAACTCCCTTTTC, downstream forward: _UP4_GCTAGAGAGATCGTTTAGAT
  • BKK22010 (Δ[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAATAACTCCCTTTTC, downstream forward: _UP4_GCTAGAGAGATCGTTTAGAT
  • References

  • 17114254,17905985,16045613,30096406,9770525,30670546,31251806