SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


required for the conversion of S-methyl-cysteine to cysteine
10.49 kDa
protein length
gene length
282 bp Sequence Blast
utilization of S-methyl-cysteine

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|Conversion of S-methyl cysteine to cysteine]
  • Gene

    3,003,049 → 3,003,330

    Phenotypes of a mutant

  • no growth with S-methyl cysteine [Pubmed|23944997]
  • The protein

    Catalyzed reaction/ biological activity

  • oxidation of S-methyl-cysteine [Pubmed|23944997]
  • Protein family

  • glutaredoxin family (single member, according to UniProt)
  • [SW|Domains]

  • Glutaredoxin domain (aa 1-93) (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials


  • BKE29320 (Δ[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCACTCATTCTTCTGTCCC, downstream forward: _UP4_GCACAGATAAAGGAGGCAAA
  • BKK29320 (Δ[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCACTCATTCTTCTGTCCC, downstream forward: _UP4_GCACAGATAAAGGAGGCAAA
  • References

  • 16109943,15668000,15272571,23944997