SubtiBank SubtiBank
yteV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yteV

sporulation protein
locus
BSU_30080
pI
4.25
mw
6.76 kDa
protein length
gene length
183 bp Sequence Blast
function
unknown
product
sporulation protein
essential
no
synonyms
cse60

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,078,393 → 3,078,575

    Expression and Regulation

    Operons

    genes
    [gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]
    description
    [Pubmed|8990290]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8990290], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|8990290]
  • view in new tab

    genes
    [gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]-[gene|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|yteR]-[gene|1482FD92CB6DC966263F08AD109769728FC708E4|yteS]-[gene|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]-[gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]-[gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE30080 (Δ[gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCCGCTCTCCTTT, downstream forward: _UP4_TAAAAAGATCTTTCCGCAGG
  • BKK30080 (Δ[gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCCGCTCTCCTTT, downstream forward: _UP4_TAAAAAGATCTTTCCGCAGG
  • References

  • 8990290