SubtiBank SubtiBank
acuB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

acuB

unknown
locus
BSU_29700
pI
6.59
mw
24.21 kDa
protein length
214 aa Sequence Blast
gene length
645 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,040,751 → 3,041,395

    The protein

    [SW|Domains]

  • 2 [SW|CBS domain]s (aa 7-66, aa 78-135) (according to UniProt)
  • Structure

  • [PDB|5AWE] (from Thermus thermophilus, 30% identity) [pubmed|26936147]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]-[gene|FC9981CFB9D7EB8ACDA3032EC2F0538988F277AA|acuB]-[gene|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]
    description
    [Pubmed|7934817]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7913927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7913927], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|7913927,12850135]
  • additional information

  • the mRNA is quite stable (half-life 5 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE29700 (Δ[gene|FC9981CFB9D7EB8ACDA3032EC2F0538988F277AA|acuB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTTTCCCCTTTGT, downstream forward: _UP4_CCGTCAGAGCAAAGGGATCT
  • BKK29700 (Δ[gene|FC9981CFB9D7EB8ACDA3032EC2F0538988F277AA|acuB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTTTCCCCTTTGT, downstream forward: _UP4_CCGTCAGAGCAAAGGGATCT
  • Expression vectors

  • pGP2922 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 7913927,16855235,7934817,16479537,19136592,26936147,12884008