SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


small regulatory RNA controlling [protein|search|AhrC ]expression, regulatory peptide
4.00 kDa
control of arginine metabolism and glycolysis
small regulatory RNA, regulatory peptide

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.9|NcRNA] → [category|SW 6.9.5|Regulatory RNAs]
  • Gene

    1,534,120 → 1,534,239


    Catalyzed reaction/ biological activity

  • hybridizes to ''[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]'' mRNA and inhibits [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC] translation [Pubmed|17020585]
  • [SW|Interactions]

  • [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA-[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA [Pubmed|20444087]
  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA]-[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA to promote base pairing between the [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA and the [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA and to control arginine metabolism [pubmed|31043113]
  • Additional information

  • Information on the structure of RNA can be found in [Pubmed|17020585]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16164558], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: repression, in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • Repressed in the presence of glucose by [protein|search|CcpN] [Pubmed|16164558]
  • view in new tab

    Biological materials


  • 168 ykzW::cat, available in [SW|Sabine Brantl]'s lab
  • GP2210 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP2215 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP2216 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • BKE14629 (Δ[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTATTCCCCATTTC, downstream forward: _UP4_TAAAAAAAAGCATGCGGCTT
  • BKK14629 (Δ[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTATTCCCCATTTC, downstream forward: _UP4_TAAAAAAAAGCATGCGGCTT
  • labs

  • [SW|Sabine Brantl], Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany [ homepage]
  • References


  • 27750368,30191807
  • Original Publications

  • 16164558,17020585,17576690,20444087,23034808,27449348,28818119,31043113
  • The peptide

    Catalyzed reaction/ biological activity:

  • the peptide controls the stability of the ''[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' mRNA [Pubmed|20444087]
  • Protein family

  • the peptide is conserved in bacilli
  • [SW|Interactions]

  • [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|GapA]-[protein|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|Sr1] [Pubmed|20444087]