SubtiBank SubtiBank
sr1
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sr1

small regulatory RNA controlling [protein|search|AhrC ]expression, regulatory peptide
locus
BSU_14629
pI
4.00
mw
4.00 kDa
function
control of arginine metabolism and glycolysis
product
small regulatory RNA, regulatory peptide
essential
no
synonyms
ykzW,sr1
Outlinks

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.9|NcRNA] → [category|SW 6.9.5|Regulatory RNAs]
  • Gene

    Coordinates
    1,534,120 → 1,534,239

    RNA

    Catalyzed reaction/ biological activity

  • hybridizes to ''[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]'' mRNA and inhibits [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC] translation [Pubmed|17020585]
  • [SW|Interactions]

  • [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA-[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA [Pubmed|20444087]
  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA]-[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA to promote base pairing between the [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA and the [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA and to control arginine metabolism [pubmed|31043113]
  • Additional information

  • Information on the structure of RNA can be found in [Pubmed|17020585]
  • Expression and Regulation

    Operons

    genes
    [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]
    description
    [Pubmed|16164558]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16164558], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: repression, in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • Repressed in the presence of glucose by [protein|search|CcpN] [Pubmed|16164558]
  • view in new tab

    Biological materials

    Mutant

  • 168 ykzW::cat, available in [SW|Sabine Brantl]'s lab
  • GP2210 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP2215 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP2216 (''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • BKE14629 (Δ[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14629 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTATTCCCCATTTC, downstream forward: _UP4_TAAAAAAAAGCATGCGGCTT
  • BKK14629 (Δ[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14629 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTATTCCCCATTTC, downstream forward: _UP4_TAAAAAAAAGCATGCGGCTT
  • labs

  • [SW|Sabine Brantl], Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany [http://www.uni-jena.de/AG_Bakteriengenetik_(_Doz__Dr__Sabine_Brantl_).html homepage]
  • References

    Reviews

  • 27750368,30191807,32850966
  • Original Publications

  • 16164558,17020585,17576690,20444087,23034808,27449348,28818119,31043113
  • The peptide

    Catalyzed reaction/ biological activity:

  • the peptide controls the stability of the ''[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' mRNA [Pubmed|20444087]
  • Protein family

  • the peptide is conserved in bacilli
  • [SW|Interactions]

  • [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|GapA]-[protein|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|Sr1] [Pubmed|20444087]