SubtiBank SubtiBank
yyzH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyzH

unknown
locus
BSU_40529
pI
9.00
mw
5.00 kDa
protein length
gene length
150 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,166,815 → 4,166,964

    Expression and Regulation

    Operons

    genes
    [gene|FC6D2E2688D0E00145086B323F68F08CB3895DBE|yyzH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE40529 (Δ[gene|FC6D2E2688D0E00145086B323F68F08CB3895DBE|yyzH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40529 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTTCACCTCTTTG, downstream forward: _UP4_TAATTGTGATGGGCATTCTT
  • BKK40529 (Δ[gene|FC6D2E2688D0E00145086B323F68F08CB3895DBE|yyzH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40529 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTTCACCTCTTTG, downstream forward: _UP4_TAATTGTGATGGGCATTCTT
  • References

  • 26577401