SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


5.00 kDa
protein length
gene length
150 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    4,166,815 → 4,166,964

    Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • BKE40529 (Δ[gene|FC6D2E2688D0E00145086B323F68F08CB3895DBE|yyzH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTTCACCTCTTTG, downstream forward: _UP4_TAATTGTGATGGGCATTCTT
  • BKK40529 (Δ[gene|FC6D2E2688D0E00145086B323F68F08CB3895DBE|yyzH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTTCACCTCTTTG, downstream forward: _UP4_TAATTGTGATGGGCATTCTT
  • References

  • 26577401