SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


conveys incoming ssDNA to [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]; facilitates the displacement of both SSBs ([protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]), increases [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] nucleation onto SSB-coated ssDNA, and mediates DNA strand annealing, required to internalize and to recombine ssDNA with homologous resident duplex
32.78 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
[category|SW 3.1.5|DNA repair/ recombination]
recombination mediator protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    1,682,580 → 1,683,473

    Phenotypes of a mutant

  • strongly impaired genetic recombination [Pubmed|23779106]
  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]'' double mutants have a strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
  • loss of plasmid transformation [pubmed|30050509]
  • The protein

    Catalyzed reaction/ biological activity

  • binds ssDNA, promotes displacement of [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] and [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] from ssDNA [Pubmed|23779106]
  • provides [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] access to ssDNA during chromosomal transformation (together with [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO]) [Pubmed|22373918]
  • [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-ATP in concert with [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] catalyzes DNA strand exchange, with [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] as an accessory factor [Pubmed|25138221]
  • the [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]-[protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA] mediator loads [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] onto any fragmented linear SPP1 ssDNA [pubmed|31876108]
  • anneals [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]- or [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB]-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates [pubmed|31876108]
  • [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA], [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO] or viral single strand annealing G35P protein, may catalyze the annealing of complete linear phage genomes with redundant regions at the ends of the molecule, alone or with the help of an exonuclease, to produce a circular unit-length duplex viral genome ready to initiate replication [pubmed|31876108]
  • Protein family

  • DprA/Smf family (single member, according to UniProt)
  • Structure

  • [PDB|3UQZ] (aa 90 ... 310, from Streptococcus pneumoniae, 44% identity) [pubmed|22904190]
  • [SW|Localization]

  • transiently localizes to the cell pole, and co-localizes with the DNA uptake machinery [Pubmed|17630974]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (2.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12850135]
  • expression is heterogeneous [pubmed|29809139]
  • view in new tab

    additional information

  • expressed under conditions that trigger genetic competence ([protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]) [Pubmed|11948146]
  • Biological materials


  • BKE16110 (Δ[gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC
  • BKK16110 (Δ[gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]::kan trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC
  • labs

  • [SW|Peter Graumann], Freiburg University, Germany [ homepage]
  • References


  • 31950915
  • Original publications

  • 17630974,17803906,12421306,18045469,11948146,22373918,23779106,23440217,25138221,26786319,28618091,22904190,28911099,30050509,31876108