SubtiBank SubtiBank
ytdA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytdA

similar to UTP-glucose-1-phosphate uridylyltransferase
locus
BSU_30850
pI
5.91
mw
30.03 kDa
protein length
272 aa Sequence Blast
gene length
819 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.7.7.9
synonyms
yzwA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,154,735 → 3,155,553

    The protein

    Catalyzed reaction/ biological activity

  • α-D-glucose 1-phosphate + H+ + UTP --> diphosphate + UDP-α-D-glucose (according to UniProt)
  • Protein family

  • UDPGP type 2 family (with [protein|D368988F85D8436DD424B0B4A1591BDF092A8EA7|GtaB] and [protein|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|YngB], according to UniProt)
  • Paralogous protein(s)

  • [protein|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|YngB], [protein|D368988F85D8436DD424B0B4A1591BDF092A8EA7|GtaB]
  • Structure

  • [PDB|3JUJ] (UDP-glucose pyrophosphorylase from ''Helicobacter pylori'', 43% identity) [Pubmed|20238176]
  • [SW|Localization]

  • outer spore coat [Pubmed|26577401]
  • Expression and Regulation

    Operons

    genes
    [gene|FC455B727F66632D94D93E103B30748944ED04A0|ytdA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during [SW|sporulation] in the mother cell ([SW|SigK]) [Pubmed|26577401]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A281 (ytdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/281 NBRP B. subtilis, Japan]
  • BKE30850 (Δ[gene|FC455B727F66632D94D93E103B30748944ED04A0|ytdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTATTTTCCCCTCAGC, downstream forward: _UP4_AAGAACCCCCAATAATTGGG
  • BKK30850 (Δ[gene|FC455B727F66632D94D93E103B30748944ED04A0|ytdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTATTTTCCCCTCAGC, downstream forward: _UP4_AAGAACCCCCAATAATTGGG
  • References

  • 26577401,20238176,22383849