SubtiBank SubtiBank
yrhK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrhK

unknown
locus
BSU_27150
pI
9.58
mw
11.50 kDa
protein length
gene length
291 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,773,356 → 2,773,646

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]-[gene|ED1DDA187692683D9862EC0E858B80CD56C48045|rsiV]-[gene|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA]-[gene|FC37C7A0C0D9F50CA1D44B8D939CF06E210D4B38|yrhK]
    description
    [Pubmed|21856855]

    sigma factors

  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21856855], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • induced by lysozyme ([protein|search|SigV]) [Pubmed|21856855]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A147 (yrhK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/147 NBRP B. subtilis, Japan]
  • BKE27150 (Δ[gene|FC37C7A0C0D9F50CA1D44B8D939CF06E210D4B38|yrhK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCATCCCTCCATTCA, downstream forward: _UP4_TGATCTTAAGGAATAAGAAA
  • BKK27150 (Δ[gene|FC37C7A0C0D9F50CA1D44B8D939CF06E210D4B38|yrhK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCATCCCTCCATTCA, downstream forward: _UP4_TGATCTTAAGGAATAAGAAA
  • References

  • 20525796,25790031