SubtiBank SubtiBank
yptA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yptA

unknown
locus
BSU_22160
pI
5.55
mw
6.92 kDa
protein length
gene length
192 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,329,515 → 2,329,706

    Biological materials

    Mutant

  • MGNA-A473 (yptA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/473 NBRP B. subtilis, Japan]
  • BKE22160 (Δ[gene|FC268E360AC286F1458AB965FE544E0E2DD7A990|yptA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCACCTCTGATGG, downstream forward: _UP4_TAAACTGCAAAAAACTTGGC
  • BKK22160 (Δ[gene|FC268E360AC286F1458AB965FE544E0E2DD7A990|yptA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCACCTCTGATGG, downstream forward: _UP4_TAAACTGCAAAAAACTTGGC