SubtiBank SubtiBank
yyaH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyaH

putative glyoxalase
locus
BSU_40860
pI
4.44
mw
14.21 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    4,196,350 → 4,196,730

    The protein

    [SW|Domains]

  • [SW|VOC domain] (aa 2-126) (according to UniProt)
  • Structure

  • [PDB|3E5D] (from Listeria monocytogenes, 56% identity)
  • Biological materials

    Mutant

  • MGNA-B866 (yyaH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1865 NBRP B. subtilis, Japan]
  • BKE40860 (Δ[gene|FC098246084DB463AAB91E51B029E9EB4056F434|yyaH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCCTCCTCCTTCG, downstream forward: _UP4_ATCTGACATCTGGAGTGACT
  • BKK40860 (Δ[gene|FC098246084DB463AAB91E51B029E9EB4056F434|yyaH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCCTCCTCCTTCG, downstream forward: _UP4_ATCTGACATCTGGAGTGACT