SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


15.73 kDa
protein length
144 aa Sequence Blast
gene length
435 bp Sequence Blast
de-bacillithiolation of S-bacillithiolated [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR] and [protein|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|MetE]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,300,221 → 2,300,655

    The protein

    Catalyzed reaction/ biological activity

  • de-bacillithiolation of S-bacillithiolated [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR] and [protein|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|MetE] [Pubmed|24313874]
  • Protein family

  • UPF0403 family (with [protein|8B134BDC82C92DB7747A3AF291C96BB0F223D0CF|BrxB], according to UniProt)
  • Paralogous protein(s)

  • [protein|8B134BDC82C92DB7747A3AF291C96BB0F223D0CF|BrxB]
  • [SW|Domains]

  • contains an CxC redox motif [Pubmed|20308541]
  • Modification

  • S-bacillithiolation upon hypochlorite stress on Cys-53 [Pubmed|21749987]
  • Structure

  • [PDB|3FHK] [Pubmed|19653655]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A879 (yphP::erm), available at the [ NBRP B. subtilis, Japan]
  • CS213 (''[gene|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|brxA]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE21860 (Δ[gene|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|brxA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGCCCCCTCTA, downstream forward: _UP4_TAAATGCCCGTTCTCCGGGC
  • BKK21860 (Δ[gene|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|brxA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGCCCCCTCTA, downstream forward: _UP4_TAAATGCCCGTTCTCCGGGC
  • References

  • 22938038,19653655,20308541,21749987,24313874