SubtiBank SubtiBank
yitP [2019-10-18 09:09:20]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yitP [2019-10-18 09:09:20]

19.78 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,183,943 → 1,184,479

    The protein

    Paralogous protein(s)

  • [protein|219092C574A13B81CD312AEB55BAE48A3C541FB7|SdpA]
  • [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [pubmed|17850253], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • induced in biofilms ([SW|DegU]) [Pubmed|17850253]
  • view in new tab

    Biological materials


  • MGNA-B200 (yitP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11070 (Δ[gene|FBA412B070CE4FFE554F2657E0F745EF5C853B8A|yitP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGACTGCTCCTTTTAA, downstream forward: _UP4_AGCATAGTCAAGGTTGTGAT
  • BKK11070 (Δ[gene|FBA412B070CE4FFE554F2657E0F745EF5C853B8A|yitP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGACTGCTCCTTTTAA, downstream forward: _UP4_AGCATAGTCAAGGTTGTGAT
  • References

  • 27766092