SubtiBank SubtiBank
degV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

degV

fatty acid binding protein
locus
BSU35480
pI
5.23
mw
31.43 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast
function
phosphorylation of fatty acids
product
fatty acid binding protein
essential
no
ec
3.6.1.1
synonyms
yviA,sacU

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • Gene

    Coordinates
    3,643,664 → 3,644,509

    The protein

    Catalyzed reaction/ biological activity

  • binds and presents fatty acids for phosphorylation to [protein|5DE73E8005AFFD30EB84696B2C2474899C6D1982|YloV] (based on findings for homologous proteins from Staphylococcus aureus) [pubmed|30429218]
  • Protein family

  • UPF0230 (degV) family (according to Swiss-Prot) PpaX family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|C13F1870B014F8B2C16D9B169F40747DE5B51B85|YitS]
  • Structure

  • [PDB|3FYS]
  • Expression and Regulation

    Operons

    genes
    [gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]
    description
    [Pubmed|8412657]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A387 (yviA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/387 NBRP B. subtilis, Japan]
  • BKE35480 (Δ[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTCGATACCTGCCT, downstream forward: _UP4_TAAGGCCAAATCTCCGTTTT
  • BKK35480 (Δ[gene|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|degV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTCGATACCTGCCT, downstream forward: _UP4_TAAGGCCAAATCTCCGTTTT
  • References

  • 19390149,8412657,30429218