SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to 16S rRNA methyltransferase
32.89 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
rRNA modification
16S rRNA methyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|rRNA modification and maturation/ based on similarity]
  • Gene

    43,921 → 44,799

    The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the 2'-O-methylation of the ribose of cytidine 1402 (C1402) in 16S rRNA (according to UniProt)
  • cytidine1402 in 16S rRNA + S-adenosyl-L-methionine --> 2'-O-methylcytidine1402 in 16S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|3KWP] (from ''Lactobacillus brevis'', 51% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation


    view in new tab



  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-B903 (yabC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00360 (Δ[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAATCCCCATGTCCGACT, downstream forward: _UP4_TAAAAAAACGTTCTTGTGTC
  • BKK00360 (Δ[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAATCCCCATGTCCGACT, downstream forward: _UP4_TAAAAAAACGTTCTTGTGTC
  • References

  • 19965768,22383849