SubtiBank SubtiBank
yabC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabC

similar to 16S rRNA methyltransferase
locus
BSU_00360
pI
5.52
mw
32.89 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
rRNA modification
product
16S rRNA methyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    43,921 → 44,799

    The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the 2'-O-methylation of the ribose of cytidine 1402 (C1402) in 16S rRNA (according to UniProt)
  • cytidine1402 in 16S rRNA + S-adenosyl-L-methionine --> 2'-O-methylcytidine1402 in 16S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|3KWP] (from ''Lactobacillus brevis'', 51% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|yabB]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|yabB]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    genes
    [gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|yabB]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B903 (yabC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1902 NBRP B. subtilis, Japan]
  • BKE00360 (Δ[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAATCCCCATGTCCGACT, downstream forward: _UP4_TAAAAAAACGTTCTTGTGTC
  • BKK00360 (Δ[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAATCCCCATGTCCGACT, downstream forward: _UP4_TAAAAAAACGTTCTTGTGTC
  • References

  • 19965768,22383849