SubtiBank SubtiBank
youB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

youB

unknown
locus
BSU_21329
pI
9.10
mw
6.50 kDa
protein length
gene length
178 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • The protein

    Paralogous protein(s)

  • [protein|CC9FD5D0543E506758F11F9048F6A8ECD737D1A9|YdzM]:
  • Biological materials

    Mutant

  • BKE21329 (Δ[gene|FB3DA9FBDE088A95E76E0FB83B1B1E8B53EC2FC1|youB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21329 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAACTCCCCCGTTTA, downstream forward: _UP4_TAAGGTGTAACACAAGGAGG
  • BKK21329 (Δ[gene|FB3DA9FBDE088A95E76E0FB83B1B1E8B53EC2FC1|youB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21329 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAACTCCCCCGTTTA, downstream forward: _UP4_TAAGGTGTAACACAAGGAGG