SubtiBank SubtiBank
cysL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cysL

transcriptional activator of the [gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]-[gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI] operon
locus
BSU_37650
pI
6.96
mw
34.04 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
function
regulation of cysteine biosynthesis
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms
ywfK,ipa-89d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,864,309 → 3,865,208

    Phenotypes of a mutant

  • unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
  • defective in [SW|biofilm formation] [pubmed|30718304]
  • The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-58) (according to UniProt)
  • Structure

  • [PDB|5Y2V] (from Synechocystis sp., 31% identity) [pubmed|29279392]
  • Expression and Regulation

    Operons

    genes
    [gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]
    description
    [Pubmed|12169591]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12169591], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL]: auto-repression, [Pubmed|12169591], in [regulon|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL regulon]
  • regulation

  • repressed by sulfate, sulfite, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B668 (ywfK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1667 NBRP B. subtilis, Japan]
  • BKE37650 (Δ[gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAACCCCACCCCTGTCA, downstream forward: _UP4_TGATATAATAGTTTTCGTTC
  • BKK37650 (Δ[gene|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAACCCCACCCCTGTCA, downstream forward: _UP4_TGATATAATAGTTTTCGTTC
  • References

  • 12169591,30718304,29279392