SubtiBank SubtiBank
opuAA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

opuAA

glycine betaine and arsenobetaine [SW|ABC transporter] (ATP-binding protein)
locus
BSU_02980
pI
5.11
mw
46.28 kDa
protein length
418 aa Sequence Blast
gene length
1257 bp Sequence Blast
function
compatible solute transport
product
glycine betaine and arsenobetaine [SW|ABC transporter] (ATP-binding protein)
essential
no
ec
3.6.3.32
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.4|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    321,013 → 322,269

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glycine betaine and arsenobetaine [pubmed|29159878]
  • uptake of dimethylglycine [Pubmed|24561588]
  • ATP + H2O + quaternary ammonium --> ADP + H+ + phosphate + quaternary ammonium (according to UniProt)
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3F502A4DCB1DAD7C3F968465B13C35213240515B|OpuBA], [protein|75DB6231129C28C5D3791BA43A1261CD46A861E8|OpuCA]
  • [SW|Domains]

  • 2 [SW|CBS domain]s (284-340, 344-403)
  • [SW|Localization]

  • associated to the membrane (via [protein|5F989C57010ACFC03E37AF5A894153F432520921|OpuAB]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA]-[gene|5F989C57010ACFC03E37AF5A894153F432520921|opuAB]-[gene|546407EFD8128D1F74443991B8D600F668FBD7A1|opuAC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23175650], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • regulation

  • induced by osmotic stress [Pubmed|23175650]
  • view in new tab

    Biological materials

    Mutant

  • BKE02980 (Δ[gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCTCCATATTA, downstream forward: _UP4_CCTTCTGCACAGGAGGTGAA
  • BKK02980 (Δ[gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCTCCATATTA, downstream forward: _UP4_CCTTCTGCACAGGAGGTGAA
  • Expression vectors

  • pGP2924 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

    Reviews

  • 27935846
  • Original publications

  • 7622480,10092453,16645306,14623183,18321243,16225868,21296969,22383849,23175650,23646920,24561588,29159878