SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


19.82 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
ribulose monophosphate pathway for formaldehyde fixation

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    374,603 → 375,160

    The protein

    Catalyzed reaction/ biological activity

  • D-arabino-hex-3-ulose 6-phosphate --> β-D-fructose 6-phosphate (according to UniProt)
  • Protein family

  • SIS family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|SIS domain] (aa 29-172) (according to UniProt)
  • Structure

  • [PDB|1M3S] [pubmed|15363790]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR]: activation, [Pubmed|10572115], in [regulon|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR regulon]
  • regulation

  • induction by formaldehyde ([protein|search|HxlR]) [Pubmed|10572115]
  • view in new tab

    Biological materials


  • MGNA-C056 (yckF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03450 (Δ[gene|FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9|hxlB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATTCAGTCGTTTTCATCG, downstream forward: _UP4_TAGCATCACACAACCGGCCT
  • BKK03450 (Δ[gene|FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9|hxlB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATTCAGTCGTTTTCATCG, downstream forward: _UP4_TAGCATCACACAACCGGCCT
  • References

  • 10572115,11468398,16428816,19170879,15363790