SubtiBank SubtiBank
yqhY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqhY

modulator of lipid biosynthesis
locus
BSU_24330
pI
4.41
mw
14.55 kDa
protein length
135 aa Sequence Blast
gene length
408 bp Sequence Blast
function
control of fatty acid biosynthesis
product
modulator of lipid biosynthesis
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.1|Biosynthesis of fatty acids]
  • Gene

    Coordinates
    2,529,926 → 2,530,333

    Phenotypes of a mutant

  • the mutant readily acquires suppressor mutants that result in reduced activity of the [SW|ACCase] [pubmed|28579978]
  • the mutant forms lipophilic clusters [pubmed|28579978]
  • The protein

    Protein family

  • asp23 family (with [protein|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|YloU], according to UniProt)
  • Paralogous protein(s)

  • [protein|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|YloU]
  • [SW|Localization]

  • cell poles [pubmed|28579978]
  • Expression and Regulation

    Operons

    genes
    [gene|ADD1CE87C1C5BA44FFF5499EA5E155C4C53A1C22|accB]-[gene|1DFFEB155028A5C6B4B344769EF7DAAC14983322|accC]-[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|yqhY]
    description
    [Pubmed|7592499]

    regulation

  • expression of the operon is strongly reduced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C367 (yqhY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2365 NBRP B. subtilis, Japan]
  • GP1468 (Δ''yqhY''::''erm''), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • GP1765 (Δ''yqhY''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • BKE24330 (Δ[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|yqhY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTCACCTCCGTAA, downstream forward: _UP4_TAAATGGCTTAACACGAAAC
  • BKK24330 (Δ[gene|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|yqhY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATTCACCTCCGTAA, downstream forward: _UP4_TAAATGGCTTAACACGAAAC
  • Expression vectors

  • GP1474 (chromosomal ''yqhY''-Strep fusion, ''aphA''3), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP1322 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP1325 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP1496 (His-tag, purification from ''E. coli'', in pET28a+), available in [SW|Jörg Stülke]'s lab
  • pGP1498 (N-terminal His-tag, TEV-site, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1471 (spc, based on [SW|pBP43]), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1481 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 17114254,7592499,23420519,24178028,28579978