SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional antiterminator of the [gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]-[gene|search|yxiE ]operon and the [gene|search|bglS ]gene
32.22 kDa
protein length
277 aa Sequence Blast
gene length
834 bp Sequence Blast
control of beta-glucan and beta-glucoside utilization
transcriptional antiterminator (BglG family)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of beta-glucosides]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    4,012,866 → 4,013,699

    Phenotypes of a mutant

  • no expression of the [gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH] operon
  • The protein

    Catalyzed reaction/ biological activity

  • binding to the mRNAs of ''[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]'' and the ''[gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]'' operon, causes transcription antitermination (in presence of salicin and absence of glucose)
  • Protein family

  • [SW|PRD-containing transcription factors]
  • Paralogous protein(s)

  • [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT], [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT], [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]
  • [SW|Domains]

  • N-terminal RNA binding domain [Pubmed|10610766]
  • 2 x [SW|PRD] ([SW|PTS] regulation domains) [Pubmed|11447120]
  • Modification

  • phosphorylation at His-100 in [SW|PRD]-1 by phosphorylated [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP], inhibits LicT antitermination activity
  • phosphorylation at His-207 and/or His-269 in [SW|PRD]-2 by His-P-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr], stimulates LicT antitermination activity
  • Structure

  • [PDB|1L1C] (complex with RAT)
  • [PDB|1TLV] ([SW|PRD]s)
  • [SW|Localization]

  • cytoplasm, even distribution in the absence of the inducer salicin, subpolar localization in the presence of salicin [Pubmed|23475962]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8606172], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • expressed in the stationary phase (temporal activation) [Pubmed|8245830]
  • view in new tab

    view in new tab

    Biological materials


  • GP427 (Δ[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]::[gene|search|erm]), available in [SW|Jörg Stülke]'s lab
  • BKE39080 (Δ[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT
  • BKK39080 (Δ[gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT
  • Expression vectors

  • for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP165, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP315, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP572, available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1225 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1221 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • [SW|Josef Deutscher], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References


  • 9663674,18086213
  • Original publications

  • 8606172,23475962,11447120,10610766,7559347,8626332,10048041,11447120,11580842,11733988,12169607,12398354,15699035,17074746,21278164,21335451,28235843