SubtiBank SubtiBank
yqbB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbB

unknown
locus
BSU26170
pI
4.79
mw
34.77 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,685,856 → 2,686,773

    Biological materials

    Mutant

  • BKE26170 (Δ[gene|FABF56076523DFCCA044374FC16D7B3416B90DD2|yqbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCAATAGCTTATCCGTTT, downstream forward: _UP4_TAAAATAGTATAATGTCCTC
  • BKK26170 (Δ[gene|FABF56076523DFCCA044374FC16D7B3416B90DD2|yqbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCAATAGCTTATCCGTTT, downstream forward: _UP4_TAAAATAGTATAATGTCCTC