SubtiBank SubtiBank
yqbB

yqbB

unknown
locus
BSU_26170
pI
4.79
mw
34.77 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,685,856 → 2,686,773

    Biological materials

    Mutant

  • BKE26170 (Δ[gene|FABF56076523DFCCA044374FC16D7B3416B90DD2|yqbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCAATAGCTTATCCGTTT, downstream forward: _UP4_TAAAATAGTATAATGTCCTC
  • BKK26170 (Δ[gene|FABF56076523DFCCA044374FC16D7B3416B90DD2|yqbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCAATAGCTTATCCGTTT, downstream forward: _UP4_TAAAATAGTATAATGTCCTC