SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


34.77 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,685,856 → 2,686,773

    Biological materials


  • BKE26170 (Δ[gene|FABF56076523DFCCA044374FC16D7B3416B90DD2|yqbB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCAATAGCTTATCCGTTT, downstream forward: _UP4_TAAAATAGTATAATGTCCTC
  • BKK26170 (Δ[gene|FABF56076523DFCCA044374FC16D7B3416B90DD2|yqbB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCAATAGCTTATCCGTTT, downstream forward: _UP4_TAAAATAGTATAATGTCCTC