SubtiBank SubtiBank
yitC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitC

mother cell-specific [SW|sporulation] protein, similar to 2-phosphosulfolactate phosphatase
locus
BSU_10940
pI
5.22
mw
24.51 kDa
protein length
228 aa Sequence Blast
gene length
687 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,172,650 → 1,173,336

    The protein

    Catalyzed reaction/ biological activity

  • (2R)-O-phospho-3-sulfolactate + H2O --> (R)-3-sulfolactate + phosphate (according to UniProt)
  • Protein family

  • ComB family (single member, according to UniProt)
  • Structure

  • [PDB|1VR0] (from Clostridium acetobutylicum, 31% identity) [pubmed|16927339]
  • Additional information

  • The gene is annotated in KEGG as ortholog of 2-phosphosulfolactate phosphatase EC 3.1.3.71. In Swiss-Prot the protein is marked as “probable 2-phosphosulfolactate phosphatase”. No EC annotation is available in MeMetaCyc.No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|FA7147930DA90604BE2B4837A8A4393F72498AB1|yitC]-[gene|97156E7227E298B0DECC9AAC1411D0DAF3420C29|yitD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([protein|search|SigE], [protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B177 (yitC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1176 NBRP B. subtilis, Japan]
  • BKE10940 (Δ[gene|FA7147930DA90604BE2B4837A8A4393F72498AB1|yitC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTACCTCTCCTTGGGC, downstream forward: _UP4_CCAACGATAGAGAGGGTCAT
  • BKK10940 (Δ[gene|FA7147930DA90604BE2B4837A8A4393F72498AB1|yitC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTACCTCTCCTTGGGC, downstream forward: _UP4_CCAACGATAGAGAGGGTCAT
  • References

  • 15699190,15383836,27766092,16927339