SubtiBank SubtiBank
yonG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yonG

unknown
locus
BSU_21100
pI
4.60
mw
35.58 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,229,988 → 2,230,908

    Biological materials

    Mutant

  • BKE21100 (Δ[gene|FA36B522D8A1F40E1B4A79A489238EEA8C59AF0E|yonG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCACCTCCATAAAG, downstream forward: _UP4_AAAATGACCTCACATAAAAA
  • BKK21100 (Δ[gene|FA36B522D8A1F40E1B4A79A489238EEA8C59AF0E|yonG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCACCTCCATAAAG, downstream forward: _UP4_AAAATGACCTCACATAAAAA