SubtiBank SubtiBank
yrhG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yrhG

similar to formate transporter
locus
BSU_27200
pI
9.46
mw
28.34 kDa
protein length
266 aa Sequence Blast
gene length
801 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,779,462 → 2,780,262

    The protein

    Protein family

  • FNT transporter (TC 2.A.44) family (with [protein|5FB51BA52819AEB4E6408A096B107ACB533C611A|YwcJ], according to UniProt)
  • Paralogous protein(s)

  • [protein|5FB51BA52819AEB4E6408A096B107ACB533C611A|YwcJ]
  • Structure

  • [PDB|3KLY] (from Vibrio cholerae, 33% identity) [pubmed|20010838]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FA18A10769974D392247FB32A0891AE74DF248A0|yrhG]
    description
    [Pubmed|21815947]

    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yrzI]' and '[protein|search|yrhG]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A148 (yrhG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/148 NBRP B. subtilis, Japan]
  • BKE27200 (Δ[gene|FA18A10769974D392247FB32A0891AE74DF248A0|yrhG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAAACGCCTCCATT, downstream forward: _UP4_TGACCAACGGGCAAATCCAT
  • BKK27200 (Δ[gene|FA18A10769974D392247FB32A0891AE74DF248A0|yrhG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAAACGCCTCCATT, downstream forward: _UP4_TGACCAACGGGCAAATCCAT
  • References

  • 20525796,21815947,20010838