SubtiBank SubtiBank
yefB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yefB

similar to site-specific recombinase
locus
BSU_06740
pI
9.30
mw
34.89 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    738,995 → 739,897

    Biological materials

    Mutant

  • MGNA-A958 (yefB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/958 NBRP B. subtilis, Japan]
  • BKE06740 (Δ[gene|FA04F512253DB11F0DA86E42C6D890ACF648D487|yefB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCGGGCAAGCTGCGAGG, downstream forward: _UP4_CCATCAGCATAGATTTTTGA
  • BKK06740 (Δ[gene|FA04F512253DB11F0DA86E42C6D890ACF648D487|yefB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCGGGCAAGCTGCGAGG, downstream forward: _UP4_CCATCAGCATAGATTTTTGA