SubtiBank SubtiBank
yefB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yefB

similar to site-specific recombinase
locus
BSU_06740
pI
9.30
mw
34.89 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    738,995 → 739,897

    Biological materials

    Mutant

  • MGNA-A958 (yefB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/958 NBRP B. subtilis, Japan]
  • BKE06740 (Δ[gene|FA04F512253DB11F0DA86E42C6D890ACF648D487|yefB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCGGGCAAGCTGCGAGG, downstream forward: _UP4_CCATCAGCATAGATTTTTGA
  • BKK06740 (Δ[gene|FA04F512253DB11F0DA86E42C6D890ACF648D487|yefB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCGGGCAAGCTGCGAGG, downstream forward: _UP4_CCATCAGCATAGATTTTTGA