SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to alcohol dehydrogenase
35.66 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,007,526 → 2,008,515

    The protein

    Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • Structure

  • [PDB|2EIH] (36% identity)
  • Additional information

  • The gene is annotated in KEGG as an ortholog of alcohol dehydrogenase EC No annotation is available in Swiss-Prot. The protein is marked in MetaCyc as “similar to alcohol dehydrogenase”. No evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B088 (yogA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18430 (Δ[gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCTGCCTCCTCAT, downstream forward: _UP4_TAAAAAAAGAAACCGGCTGG
  • BKK18430 (Δ[gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCTGCCTCCTCAT, downstream forward: _UP4_TAAAAAAAGAAACCGGCTGG
  • References

  • 22383849