SubtiBank SubtiBank
yogA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yogA

similar to alcohol dehydrogenase
locus
BSU_18430
pI
8.05
mw
35.66 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,007,526 → 2,008,515

    The protein

    Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • Structure

  • [PDB|2EIH] (36% identity)
  • Additional information

  • The gene is annotated in KEGG as an ortholog of alcohol dehydrogenase EC 1.1.1.1. No annotation is available in Swiss-Prot. The protein is marked in MetaCyc as “similar to alcohol dehydrogenase”. No evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B088 (yogA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1087 NBRP B. subtilis, Japan]
  • BKE18430 (Δ[gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCTGCCTCCTCAT, downstream forward: _UP4_TAAAAAAAGAAACCGGCTGG
  • BKK18430 (Δ[gene|F9DC5EEF3E9BA8F04F401A183340C475B9058B38|yogA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTCTGCCTCCTCAT, downstream forward: _UP4_TAAAAAAAGAAACCGGCTGG
  • References

  • 22383849