SubtiBank SubtiBank
aldY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aldY

aldehyde dehydrogenase (NAD), general stress protein, required for protection against paraquat stress
locus
BSU_38830
pI
5.02
mw
52.65 kDa
protein length
485 aa Sequence Blast
gene length
1458 bp Sequence Blast
function
stress resistance
product
aldehyde dehydrogenase (NAD)
essential
no
synonyms
yxkE

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,986,428 → 3,987,885

    The protein

    Catalyzed reaction/ biological activity

  • aldehyde + H2O + NAD+ --> carboxylate + 2 H+ + NADH (according to UniProt)
  • Protein family

  • [SW|aldehyde dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|DhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX]
  • Structure

  • [PDB|4DNG]
  • Expression and Regulation

    Operons

    genes
    [gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]
    description
    [Pubmed|10482513]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10482513]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B739 (aldY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1738 NBRP B. subtilis, Japan]
  • BKE38830 (Δ[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATGACCCTCCTTTG, downstream forward: _UP4_TAAATGAAAAAATCCCTCTG
  • BKK38830 (Δ[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATGACCCTCCTTTG, downstream forward: _UP4_TAAATGAAAAAATCCCTCTG
  • References

  • 15805528,10482513,22582280