SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


aldehyde dehydrogenase (NAD), general stress protein, required for protection against paraquat stress
52.65 kDa
protein length
485 aa Sequence Blast
gene length
1458 bp Sequence Blast
stress resistance
aldehyde dehydrogenase (NAD)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,986,428 → 3,987,885

    The protein

    Protein family

  • aldehyde dehydrogenase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|DhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX]
  • Structure

  • [PDB|4DNG]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10482513]
  • view in new tab

    Biological materials


  • MGNA-B739 (aldY::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38830 (Δ[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATGACCCTCCTTTG, downstream forward: _UP4_TAAATGAAAAAATCCCTCTG
  • BKK38830 (Δ[gene|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATGACCCTCCTTTG, downstream forward: _UP4_TAAATGAAAAAATCCCTCTG
  • References

  • 15805528,10482513,22582280