SubtiBank SubtiBank
yorZ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yorZ

unknown
locus
BSU_20200
pI
8.05
mw
7.86 kDa
protein length
gene length
213 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,170,030 → 2,170,242

    Biological materials

    Mutant

  • BKE20200 (Δ[gene|F9CA86E25E389C796FBEE596C6C0D43A717D7E95|yorZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAACACTCTCCTTCGCC, downstream forward: _UP4_TAAAATATTCCTTTTATACA
  • BKK20200 (Δ[gene|F9CA86E25E389C796FBEE596C6C0D43A717D7E95|yorZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAACACTCTCCTTCGCC, downstream forward: _UP4_TAAAATATTCCTTTTATACA