SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.75 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,365,391 → 3,365,831

    The protein


  • [SW|TOPRIM domain] (aa 31-119) [Pubmed|9722641]
  • Structure

  • [PDB|2I5R] (small [SW|TOPRIM domain] in complex with Mg2+, Geobacillus stearothermophilus) [Pubmed|17705269]
  • [PDB|2FCJ] (small [SW|TOPRIM domain], Geobacillus stearothermophilus) [Pubmed|17705269]
  • Biological materials


  • MGNA-B591 (yusF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32780 (Δ[gene|F992A3430FC14119D01F83A5286FBF29E0CA1E45|yusF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCAGTGAAATTCACCGCCA, downstream forward: _UP4_GAAAGAAAGTCCCGAGGTGT
  • BKK32780 (Δ[gene|F992A3430FC14119D01F83A5286FBF29E0CA1E45|yusF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCAGTGAAATTCACCGCCA, downstream forward: _UP4_GAAAGAAAGTCCCGAGGTGT
  • References

  • 9722641,17705269