SubtiBank SubtiBank
rplK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rplK

ribosomal protein
locus
BSU_01020
pI
9.72
mw
14.78 kDa
protein length
141 aa Sequence Blast
gene length
426 bp Sequence Blast
function
translation
product
ribosomal protein L11 (BL11)
essential
no
synonyms
relC,tsp

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]
  • Gene

    Coordinates
    118,591 → 119,016

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Protein family

  • Universal [SW|ribosomal protein] uL11 family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-94 [Pubmed|22517742]
  • Structure

  • [PDB|1FOX] (C-terminal domain, Geobacillus stearothermophilus)
  • [PDB|2FOW] (RNA binding domain in complex with RNA, Geobacillus stearothermophilus)
  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]-[gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]-[gene|E4D89640D0F0A31A2814D20FB5425FDB0B46A43D|BSU_misc_RNA_3]-[gene|5EF3A7953AA97D2B44C967542A53FEA7F36D7BA3|rplJ]-[gene|E72910604D3DC2A62AE8A951F55570EA2838B250|rplL]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • BKE01020 (Δ[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGACACACCTCCTTAA, downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
  • BKK01020 (Δ[gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGACACACCTCCTTAA, downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
  • References

  • 11244072,11948165,19653700,20441189,20525796,22517742,112097,23002217,25903689,28516784,28189581