SubtiBank SubtiBank
cstA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cstA

similar to pyruvate transporter, carbon starvation-induced protein
locus
BSU_28710
pI
8.66
mw
64.19 kDa
protein length
598 aa Sequence Blast
gene length
1797 bp Sequence Blast
function
uptake of pyruvate
product
putative pyruvate transporter, carbon starvation-induced protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,936,382 → 2,938,178

    The protein

    Catalyzed reaction/ biological activity

  • pyruvate:H+ symport [pubmed|29061664]
  • Protein family

  • peptide transporter carbon starvation (CstA) (TC 2.A.114) family (single member, according to UniProt)
  • [SW|Localization]

  • membrane (according to [http://www.uniprot.org/uniprot/P94532 UniProt])
  • Expression and Regulation

    Operons

    genes
    [gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]-[gene|5E483479E65CF5E648A88F3B9029CCE555B27898|ysfE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.4-fold) ([protein|search|CcpA]) [Pubmed|12850135,22900538]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B012 (cstA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1011 NBRP B. subtilis, Japan]
  • BKE28710 (Δ[gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCCATCCCCTTT, downstream forward: _UP4_TAGAAGGACTATTGAAAATG
  • BKK28710 (Δ[gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCCATCCCCTTT, downstream forward: _UP4_TAGAAGGACTATTGAAAATG
  • References

    The ''E. coli'' homolog

  • 1848300,29061664