SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to N-acetyltransferase
19.94 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,375,777 → 1,376,295

    The protein

    Paralogous protein(s)

  • [protein|18FA5EFCD78C74296F9E52A64DA4A9D635944528|YnaD]:
  • [protein|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|YjcK]:
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 12-172) (according to UniProt)
  • Structure

  • [PDB|3FBU] (from ''Bacillus Anthracis'', 35% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A746 (ykkB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13080 (Δ[gene|F92B7EC7A00BF295666D68613932D239F92C7347|ykkB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTCGATCAGTCACAAGCT, downstream forward: _UP4_TGAAAGATAGAGCTGAGTTT
  • BKK13080 (Δ[gene|F92B7EC7A00BF295666D68613932D239F92C7347|ykkB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTCGATCAGTCACAAGCT, downstream forward: _UP4_TGAAAGATAGAGCTGAGTTT
  • References

  • 27965289