SubtiBank SubtiBank
ykkB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykkB

similar to N-acetyltransferase
locus
BSU_13080
pI
9.67
mw
19.94 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,375,777 → 1,376,295

    The protein

    Paralogous protein(s)

  • [protein|18FA5EFCD78C74296F9E52A64DA4A9D635944528|YnaD]:
  • [protein|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|YjcK]:
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 12-172) (according to UniProt)
  • Structure

  • [PDB|3FBU] (from ''Bacillus Anthracis'', 35% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|2FCC71494ABD640AB009B155299EA888B88F90A3|bstF]-[gene|F92B7EC7A00BF295666D68613932D239F92C7347|ykkB]
    description
    [Pubmed|27965289]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A746 (ykkB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/746 NBRP B. subtilis, Japan]
  • BKE13080 (Δ[gene|F92B7EC7A00BF295666D68613932D239F92C7347|ykkB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTCGATCAGTCACAAGCT, downstream forward: _UP4_TGAAAGATAGAGCTGAGTTT
  • BKK13080 (Δ[gene|F92B7EC7A00BF295666D68613932D239F92C7347|ykkB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTCGATCAGTCACAAGCT, downstream forward: _UP4_TGAAAGATAGAGCTGAGTTT
  • References

  • 27965289