SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


beta-xyloside permease
51.37 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
xylan utilization
beta-xyloside permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of xylan/ xylose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,887,352 → 1,888,743

    The protein

    Protein family

  • [SW|sodium:galactoside symporter (TC 2.A.2) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B13F7C35FBD55C674E5B19836D32279E7C1A5520|GutP], [protein|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|YjmB]
  • Structure

  • [PDB|4M64] (melibiose permease from Salmonella typhimurium, 31% identity) [pubmed|24389923]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9973552], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|9973552], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]: repression, [Pubmed|9973552], in [regulon|AF4395D134485290F4AA307B48494FED39E52CD7|XylR regulon]
  • regulation

  • carbon catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|9973552]
  • induction by xylose ([protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]) [Pubmed|9973552]
  • view in new tab

    Biological materials


  • MGNA-B107 (ynaJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17570 (Δ[gene|F92925E2FDCFE6DDA3E87C7B541FE6A6CE5AABB8|xynP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCCCTTTTCG, downstream forward: _UP4_TAAAAAAGAAAATAAACTGA
  • BKK17570 (Δ[gene|F92925E2FDCFE6DDA3E87C7B541FE6A6CE5AABB8|xynP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCCCTTTTCG, downstream forward: _UP4_TAAAAAAGAAAATAAACTGA
  • lacZ fusion

  • pGP417 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

    Carbon catabolite repression

  • 18757537,9973552,22001508,22900538,24389923