SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


short chain reductase involved in bacilysin synthesis
27.87 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
biosynthesis of the antibiotic bacilysin
short chain reductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    3,867,493 → 3,868,272

    The protein

    Catalyzed reaction/ biological activity

  • BacG catalyzes the conjugate addition of hydride at the C4 olefinic terminus using NADH to yield the cyclohexenol- containing tetrahydro-4-hydroxyphenylpyruvate [Pubmed|20052993]
  • stereoselective reduction of dihydro-hydroxyphenylpyruvate (H2HPP) to tetrahydro-hydroxyphenylpyruvate (H4HPP), NADPH-dependent reductase that facilitates the conjugate addition of a hydride at the C(4) olefin terminus of H2HPP [Pubmed|23519407]
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • [SW|Cofactors]

  • NADPH [Pubmed|23519407]
  • Structure

  • [PDB|3U49] [Pubmed|23519407]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials


  • MGNA-A515 (ywfH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG, downstream forward: _UP4_AGCATATAAAAACATCCCGC
  • BKK37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG, downstream forward: _UP4_AGCATATAAAAACATCCCGC
  • References

  • 12372825,12107147,20052993,21948839,23519407