SubtiBank SubtiBank
bacG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bacG

short chain reductase involved in bacilysin synthesis
locus
BSU37680
pI
6.60
mw
27.87 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
biosynthesis of the antibiotic bacilysin
product
short chain reductase
essential
no
synonyms
ipa-86r,ywfH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,867,493 → 3,868,272

    The protein

    Catalyzed reaction/ biological activity

  • BacG catalyzes the conjugate addition of hydride at the C4 olefinic terminus using NADH to yield the cyclohexenol- containing tetrahydro-4-hydroxyphenylpyruvate [Pubmed|20052993]
  • stereoselective reduction of dihydro-hydroxyphenylpyruvate (H2HPP) to tetrahydro-hydroxyphenylpyruvate (H4HPP), NADPH-dependent reductase that facilitates the conjugate addition of a hydride at the C(4) olefin terminus of H2HPP [Pubmed|23519407]
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • [SW|Cofactors]

  • NADPH [Pubmed|23519407]
  • Structure

  • [PDB|3U49] [Pubmed|23519407]
  • Expression and Regulation

    Operons

    genes
    [gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]
    description
    [Pubmed|12372825]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A515 (ywfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/515 NBRP B. subtilis, Japan]
  • BKE37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG, downstream forward: _UP4_AGCATATAAAAACATCCCGC
  • BKK37680 (Δ[gene|F8FF994BF2FDFB27DE63C1F8FB75DAB7E90FC78C|bacG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAACTGCACCCCTTTG, downstream forward: _UP4_AGCATATAAAAACATCCCGC
  • References

  • 12372825,12107147,20052993,21948839,23519407