SubtiBank SubtiBank
csbA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csbA

general stress protein, required for protection against paraquat stress
locus
BSU_35180
pI
9.30
mw
8.33 kDa
protein length
gene length
231 bp Sequence Blast
function
protection against paraquat stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,615,116 → 3,615,346

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F8FDCE60F815597F228D8D1E6E05149EDF69835D|csbA]
    description
    [Pubmed|1744042]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1744042], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|1744042,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|1744042,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A393 (csbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/393 NBRP B. subtilis, Japan]
  • BKE35180 (Δ[gene|F8FDCE60F815597F228D8D1E6E05149EDF69835D|csbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACCCTCCTCAGG, downstream forward: _UP4_TAAATCGGACATAATGAATA
  • BKK35180 (Δ[gene|F8FDCE60F815597F228D8D1E6E05149EDF69835D|csbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACCCTCCTCAGG, downstream forward: _UP4_TAAATCGGACATAATGAATA
  • References

  • 1744042,22582280,15805528