SubtiBank SubtiBank
csbA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csbA

general stress protein, required for protection against paraquat stress
locus
BSU35180
pI
9.30
mw
8.33 kDa
protein length
gene length
231 bp Sequence Blast
function
protection against paraquat stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,615,116 → 3,615,346

    The protein

    [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F8FDCE60F815597F228D8D1E6E05149EDF69835D|csbA]
    description
    [Pubmed|1744042]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1744042], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|1744042,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|1744042,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A393 (csbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/393 NBRP B. subtilis, Japan]
  • BKE35180 (Δ[gene|F8FDCE60F815597F228D8D1E6E05149EDF69835D|csbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACCCTCCTCAGG, downstream forward: _UP4_TAAATCGGACATAATGAATA
  • BKK35180 (Δ[gene|F8FDCE60F815597F228D8D1E6E05149EDF69835D|csbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACCCTCCTCAGG, downstream forward: _UP4_TAAATCGGACATAATGAATA
  • References

  • 1744042,22582280,15805528