SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


Na+/malate symporter
47.66 kDa
protein length
448 aa Sequence Blast
gene length
1347 bp Sequence Blast
malate uptake
Na+/malate symporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,244,770 → 3,246,116

    The protein

    Protein family

  • sodium:citrate (SCF) symporter family (together with [protein|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|CimH], according to UniProt)
  • Paralogous protein(s)

  • [protein|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|CimH]
  • Structure

  • [PDB|5X9R] (from Klebsiella pneumoniae, 34% identity) [pubmed|28566738]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • induced by malate ([protein|search|MalR])
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-B556 (yufR::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A642 (''maeN''::Tn917, erm) (available from the [ BGSC] or in [SW|Jörg Stülke]'s lab)
  • 1A642 ( ''maeN''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • GP1449 (''erm''), available in [SW|Stülke] lab
  • BKE31580 (Δ[gene|F8F62635AA87E4E3A255D6F8FC621EF40954B520|maeN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATACACCCCCATGT, downstream forward: _UP4_TAAACAGAAAGAGTTCCGTT
  • BKK31580 (Δ[gene|F8F62635AA87E4E3A255D6F8FC621EF40954B520|maeN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATACACCCCCATGT, downstream forward: _UP4_TAAACAGAAAGAGTTCCGTT
  • Expression vectors

  • expression of native ''maeN'' in ''B. subtilis'': pGP1951 (in [SW|pBQ200]), available in [SW|Stülke] lab
  • References


  • 16339740
  • Original publications

  • 19087206,12949159,12949159,21815947,28566738