SubtiBank SubtiBank
mutSB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mutSB

probable DNA mismatch repair protein
locus
BSU_28580
pI
5.79
mw
87.23 kDa
protein length
785 aa Sequence Blast
gene length
2358 bp Sequence Blast
function
DNA repair
product
probable DNA mismatch repair protein
essential
no
synonyms
yshD,mutS2

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,920,936 → 2,923,293

    The protein

    Protein family

  • DNA mismatch repair mutS family (with [protein|E2A8B04CD729332F9E6A13195181983F751F2F25|MutS], according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]-[gene|93726C423313C653C4F71CB107FA12F686959E41|yshB]-[gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]-[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB]-[gene|18CEF3F1EE2E95A009699DE370CBB44F025B7B40|yshE]
    description
    [Pubmed|22383849]

    regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B007 (yshD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1006 NBRP B. subtilis, Japan]
  • 1A845 ( ''mutSB''::''cat''), [Pubmed|11254128], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A845&Search=1A845 BGSC]
  • 1A845 ( ''mutSB''::''cat''), [Pubmed|11254128], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A845&Search=1A845 BGSC]
  • BKE28580 (Δ[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATTGTGTGAGCCTCCT, downstream forward: _UP4_CTAAAATAAAAGGGAGTATG
  • BKK28580 (Δ[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATTGTGTGAGCCTCCT, downstream forward: _UP4_CTAAAATAAAAGGGAGTATG
  • labs

  • [SW|Alessandra Albertini], University of Pavia, Italy [http://www-1.unipv.it/genbiom/albertini.html homepage]
  • References

    Reviews

  • 22933559
  • Original publications

  • 11254128,27799325,30814990