SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


probable DNA mismatch repair protein
87.23 kDa
protein length
785 aa Sequence Blast
gene length
2358 bp Sequence Blast
DNA repair
probable DNA mismatch repair protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,920,936 → 2,923,293

    The protein

    Protein family

  • DNA mismatch repair mutS family (with [protein|E2A8B04CD729332F9E6A13195181983F751F2F25|MutS], according to UniProt)
  • [SW|Domains]

  • Smr domain (aa 710-785) (according to UniProt)
  • Expression and Regulation




  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials


  • MGNA-B007 (yshD::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A845 ( ''mutSB''::''cat''), [Pubmed|11254128], available at [ BGSC]
  • 1A845 ( ''mutSB''::''cat''), [Pubmed|11254128], available at [ BGSC]
  • BKE28580 (Δ[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATTGTGTGAGCCTCCT, downstream forward: _UP4_CTAAAATAAAAGGGAGTATG
  • BKK28580 (Δ[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATTGTGTGAGCCTCCT, downstream forward: _UP4_CTAAAATAAAAGGGAGTATG
  • labs

  • [SW|Alessandra Albertini], University of Pavia, Italy [ homepage]
  • References


  • 22933559
  • Original publications

  • 11254128,27799325,30814990