SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


Hit-like protein involved in cell-cycle regulation, similar to Ap4A hydrolase
16.16 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
cell-cycle regulation
Hit-like protein involved in cell-cycle regulation

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • Gene

    1,076,515 → 1,076,952

    The protein


  • HIT domain (aa 8-116) (according to UniProt)
  • Structure

  • [PDB|1Y23]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A688 (hit::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10030 (Δ[gene|F8E5A679BB15E5714A5EBE5FF001429D6FFA8B66|hit]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGGTTCCTCCTTATG, downstream forward: _UP4_TAAGATGAGGTTATTTTATT
  • BKK10030 (Δ[gene|F8E5A679BB15E5714A5EBE5FF001429D6FFA8B66|hit]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGGTTCCTCCTTATG, downstream forward: _UP4_TAAGATGAGGTTATTTTATT