SubtiBank SubtiBank
hit
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hit

Hit-like protein involved in cell-cycle regulation, similar to Ap4A hydrolase
locus
BSU_10030
pI
6.13
mw
16.16 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
cell-cycle regulation
product
Hit-like protein involved in cell-cycle regulation
essential
no
synonyms
yhaE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • Gene

    Coordinates
    1,076,515 → 1,076,952

    The protein

    [SW|Domains]

  • HIT domain (aa 8-116) (according to UniProt)
  • Structure

  • [PDB|1Y23]
  • Expression and Regulation

    Operons

    genes
    [gene|F8E5A679BB15E5714A5EBE5FF001429D6FFA8B66|hit]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A688 (hit::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/688 NBRP B. subtilis, Japan]
  • BKE10030 (Δ[gene|F8E5A679BB15E5714A5EBE5FF001429D6FFA8B66|hit]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGGTTCCTCCTTATG, downstream forward: _UP4_TAAGATGAGGTTATTTTATT
  • BKK10030 (Δ[gene|F8E5A679BB15E5714A5EBE5FF001429D6FFA8B66|hit]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGGTTCCTCCTTATG, downstream forward: _UP4_TAAGATGAGGTTATTTTATT