SubtiBank SubtiBank
yqeU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeU

ribosomal RNA small subunit methyltransferase E
locus
BSU_25440
pI
5.29
mw
28.65 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
rRNA maturation
product
ribosomal RNA small subunit methyltransferase E
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    2,623,032 → 2,623,802

    The protein

    Catalyzed reaction/ biological activity

  • S-adenosyl-L-methionine + uridine1498 in 16S rRNA --> H+ + N3-methyluridine1498 in 16S rRNA + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • RNA methyltransferase rsmE family (single member, according to UniProt)
  • Structure

  • [PDB|1VHK] [pubmed|16021622]
  • Expression and Regulation

    Operons

    genes
    [gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
    description
    [Pubmed|9023197]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-C497 (yqeU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2495 NBRP B. subtilis, Japan]
  • BKE25440 (Δ[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGCTGTGACACCTACT, downstream forward: _UP4_GAGTTATTAAGAGGTGATCA
  • BKK25440 (Δ[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGCTGTGACACCTACT, downstream forward: _UP4_GAGTTATTAAGAGGTGATCA
  • References

  • 10383760,9023197,7592421,16021622,26883633