SubtiBank SubtiBank
yqeU
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqeU

ribosomal RNA small subunit methyltransferase E
locus
BSU_25440
pI
5.29
mw
28.65 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
rRNA maturation
product
ribosomal RNA small subunit methyltransferase E
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    2,623,032 → 2,623,802

    The protein

    Catalyzed reaction/ biological activity

  • S-adenosyl-L-methionine + uridine1498 in 16S rRNA --> H+ + N3-methyluridine1498 in 16S rRNA + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • RNA methyltransferase rsmE family (single member, according to UniProt)
  • Structure

  • [PDB|1VHK] [pubmed|16021622]
  • Expression and Regulation

    Operons

    genes
    [gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
    description
    [Pubmed|9023197]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-C497 (yqeU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2495 NBRP B. subtilis, Japan]
  • BKE25440 (Δ[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGCTGTGACACCTACT, downstream forward: _UP4_GAGTTATTAAGAGGTGATCA
  • BKK25440 (Δ[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGCTGTGACACCTACT, downstream forward: _UP4_GAGTTATTAAGAGGTGATCA
  • References

  • 10383760,9023197,7592421,16021622,26883633