SubtiBank SubtiBank
yxeO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxeO

putative S-(2-succino)cysteine [SW|ABC transporter] (ATP-binding protein)
locus
BSU_39480
pI
7.37
mw
27.59 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
function
uptake and utilization of S-(2-succino)cysteine
product
putative S-(2-succino)cysteine [SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.9|Biosynthesis/ acquisition of cysteine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.3|Conversion of S-(2-succino)cysteine to cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,058,029 → 4,058,778

    Phenotypes of a mutant

  • defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
  • The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|PstBB], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|6882EF93EC82872B25C88104F62D6603D2514890|ArtR], [protein|B24763A732111026D21C828FF9BE73FB22A123CF|TcyN], [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|434BCED6953BE07D592AC229264C5AD0D04CBAF6|PstBA]
  • Structure

  • [PDB|4YMS] (from Caldanaerobacter subterraneus, 53% identity) [pubmed|25848002]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|19E6EF9CCA31440EAC046F8D6CA98B6A08589D58|yxeK]-[gene|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|snaB]-[gene|D96EEDABB73AC66E6AB772431819E7C767DC8B9A|yxeM]-[gene|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|yxeN]-[gene|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|yxeO]-[gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB]-[gene|7DDB283173267AA106DC277787AAAB4F4F9975F4|yxeQ]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]) [Pubmed|16513748]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B711 (yxeO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1710 NBRP B. subtilis, Japan]
  • 1A950 ( ''yxeO''::''cat''), [Pubmed|15262924], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A950&Search=1A950 BGSC]
  • BKE39480 (Δ[gene|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|yxeO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTGTTATCAACTGATTTC, downstream forward: _UP4_CTTATATAAGAAGGGGAGAA
  • BKK39480 (Δ[gene|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|yxeO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTGTTATCAACTGATTTC, downstream forward: _UP4_CTTATATAAGAAGGGGAGAA
  • References

  • 10092453,12193636,25875741,16513748,25848002,29626092