SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


fatty acid degradation, similar to proline dehydrogenase
34.30 kDa
protein length
302 aa Sequence Blast
gene length
909 bp Sequence Blast
fatty acid degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    3,372,740 → 3,373,648

    The protein

    Catalyzed reaction/ biological activity

  • quinone + L-proline --> (S)-1-pyrroline-5-carboxylate + quinol + H+ (according to UniProt)
  • Protein family

  • proline dehydrogenase family (with [protein|1F548515402950572E7212901729B2480432D1B9|PutB], according to UniProt)
  • Paralogous protein(s)

  • [protein|1F548515402950572E7212901729B2480432D1B9|PutB]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4H6Q] (from Deinococcus radiodurans, 48% identity) [pubmed|23151026]
  • Expression and Regulation



    regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: activation, [Pubmed|12817086], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • regulation

  • ''[protein|search|fadM]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials


  • MGNA-A598 (yusM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32850 (Δ[gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGACTCCCTCCCGCCG, downstream forward: _UP4_TGAAAGCAGCCGTGGGAAGC
  • BKK32850 (Δ[gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGACTCCCTCCCGCCG, downstream forward: _UP4_TGAAAGCAGCCGTGGGAAGC
  • References

  • 17189250,12817086,23151026