SubtiBank SubtiBank
fur
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fur

transcription regulator of iron homoeostasis, sensor of Fe sufficiency
locus
BSU_23520
pI
5.37
mw
17.26 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
regulation of iron homoeostasis
product
transcriptional repressor [SW|Fur family]
essential
no
synonyms
yqkL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,449,841 → 2,450,290

    Phenotypes of a mutant

  • no growth with glucose and ammonium as single sources of carbon and nitrogen, respectively (due to [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]-mediated repression of the ''[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]'' operon) [Pubmed|22389480]
  • poor growth on lactate as single carbon source (due to overexpression of [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]-mediated repression of the ''[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]'' operon, can be suppressed by inactivation of ''[gene|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]'' or ''[gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]'') [Pubmed|22427629]
  • transcription profile of a ''[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]'' mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE27416 GEO] [Pubmed|22389480]
  • The protein

    Protein family

  • [SW|Fur family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR], [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]
  • [SW|Cofactors]

  • Fe2+ [pubmed|28938859]
  • Effectors of protein activity

  • DNA binding activity (repression) is triggered by binding of Fe2+ [Pubmed|23057863]
  • Structure

  • [PDB|4ETS] (from Campylobacter jejuni, 33% identity) [pubmed|22665794]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]
    description
    [Pubmed|12029044]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029044], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|12029044], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • repressed in the absence of hydrogen peroxide ([protein|search|PerR]) [Pubmed|12029044]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C426 (yqkL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2424 NBRP B. subtilis, Japan]
  • HB6543 (aphA3), available in the [SW|John Helmann]'s lab
  • GP879 (''fur::mls'') and GP868 (''fur::mls'', ''perR::spc''), available in the [SW|Jörg Stülke]'s lab
  • 1A910 ( ''fur''::''kan''), [Pubmed|12029044], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A910&Search=1A910 BGSC]
  • BKE23520 (Δ[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCCCTCCTACGC, downstream forward: _UP4_TAGACGGTGCCGAGCGCGAA
  • BKK23520 (Δ[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCCCTCCTACGC, downstream forward: _UP4_TAGACGGTGCCGAGCGCGAA
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 15802251,25209494,25160631,28938859
  • The [SW|Fur regulon]

  • 12374814,12354229,22389480,21873409,29133393
  • Other original publications

  • 18487332,14563870,18697947,10400588,11790741,12207695,9701813,12029044,22427629,17725565,17012385,12950915,19508286,16672620,23057863,25486128,28439033,29133393,30377275,22665794,31988078,32949815