SubtiBank SubtiBank
yfkM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfkM

glyoxalase III-like enzyme, general stress protein, survival of salt, paraquat and ethanol stresses
locus
BSU_07850
pI
4.72
mw
18.72 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
detoxification of methylglyoxal
product
glyoxalase III-like enzyme
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    859,745 → 860,263

    The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal -→ D-lactate [Pubmed|24330391]
  • Protein family

  • [SW|peptidase C56 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|YraA]
  • [SW|Domains]

  • [SW|PfpI endopeptidase domain] (aa 3-171) (according to UniProt)
  • Structure

  • [PDB|1OI4] (from E. coli, 64% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]
    description
    [Pubmed|12354229]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C264 (yfkM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2262 NBRP B. subtilis, Japan]
  • BKE07850 (Δ[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATAACCTCCCGC, downstream forward: _UP4_TAAGAAAAAACGGACGCTCT
  • BKK07850 (Δ[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATAACCTCCCGC, downstream forward: _UP4_TAAGAAAAAACGGACGCTCT
  • References

  • 10220166,24330391,12354229,15805528,22582280