SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glyoxalase III-like enzyme, general stress protein, survival of salt, paraquat and ethanol stresses
18.72 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
detoxification of methylglyoxal
glyoxalase III-like enzyme

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    859,745 → 860,263

    The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal -→ D-lactate [Pubmed|24330391]
  • Protein family

  • [SW|peptidase C56 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|YraA]
  • Structure

  • [PDB|1OI4] (from E. coli, 64% identity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-C264 (yfkM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07850 (Δ[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATAACCTCCCGC, downstream forward: _UP4_TAAGAAAAAACGGACGCTCT
  • BKK07850 (Δ[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATAACCTCCCGC, downstream forward: _UP4_TAAGAAAAAACGGACGCTCT
  • References

  • 10220166,24330391,12354229,15805528,22582280