SubtiBank SubtiBank
yfkM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfkM

glyoxalase III-like enzyme, general stress protein, survival of salt, paraquat and ethanol stresses
locus
BSU07850
pI
4.72
mw
18.72 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
detoxification of methylglyoxal
product
glyoxalase III-like enzyme
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    859,745 → 860,263

    The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal -→ D-lactate [Pubmed|24330391]
  • Protein family

  • PfpI endopeptidase domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|YraA]
  • Structure

  • [PDB|1OI4] (from E. coli, 64% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]
    description
    [Pubmed|12354229]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C264 (yfkM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2262 NBRP B. subtilis, Japan]
  • BKE07850 (Δ[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATAACCTCCCGC, downstream forward: _UP4_TAAGAAAAAACGGACGCTCT
  • BKK07850 (Δ[gene|F88F0153CAFC1E51F2586F733AFDF22320642151|yfkM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATAACCTCCCGC, downstream forward: _UP4_TAAGAAAAAACGGACGCTCT
  • References

  • 10220166,24330391,12354229,15805528,22582280