SubtiBank SubtiBank


spore germination protein, facilitates access of nutrient germinants to their cognate germinant receptors in spores’ inner membrane
6.13 kDa
protein length
gene length
177 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    1,149,145 → 1,149,321

    Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10715007]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|gerPA]' and '[protein|search|yisI]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE10690 (Δ[gene|F8658BB6D52793F8EC289FEC652241D729D72BF6|gerPD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTGCGGTTGATGACTGTAA, downstream forward: _UP4_TTTGCTCCGCTTGCGCCAGA
  • BKK10690 (Δ[gene|F8658BB6D52793F8EC289FEC652241D729D72BF6|gerPD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTGCGGTTGATGACTGTAA, downstream forward: _UP4_TTTGCTCCGCTTGCGCCAGA
  • References

  • 10715007,27766092