SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


spore germination protein, facilitates access of nutrient germinants to their cognate germinant receptors in spores’ inner membrane
6.13 kDa
protein length
gene length
177 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    1,149,145 → 1,149,321

    Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10715007]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|gerPA]' and '[protein|search|yisI]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE10690 (Δ[gene|F8658BB6D52793F8EC289FEC652241D729D72BF6|gerPD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTGCGGTTGATGACTGTAA, downstream forward: _UP4_TTTGCTCCGCTTGCGCCAGA
  • BKK10690 (Δ[gene|F8658BB6D52793F8EC289FEC652241D729D72BF6|gerPD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTGCGGTTGATGACTGTAA, downstream forward: _UP4_TTTGCTCCGCTTGCGCCAGA
  • References

  • 10715007,27766092