SubtiBank SubtiBank
yqjA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqjA

unknown
locus
BSU_23950
pI
8.74
mw
36.98 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,489,535 → 2,490,503

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C384 (yqjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2382 NBRP B. subtilis, Japan]
  • GP2203 (''[gene|F83EA9CAB8C3AD306F8E70E0DF8C798DC9F6F13B|yqjA]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKE23950 (Δ[gene|F83EA9CAB8C3AD306F8E70E0DF8C798DC9F6F13B|yqjA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGACTCCATTTCTA, downstream forward: _UP4_TGATTCGCATGAGCTCTTCC
  • BKK23950 (Δ[gene|F83EA9CAB8C3AD306F8E70E0DF8C798DC9F6F13B|yqjA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGACTCCATTTCTA, downstream forward: _UP4_TGATTCGCATGAGCTCTTCC