SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


36.98 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,489,535 → 2,490,503

    The protein


  • cell membrane (according to UniProt)
  • Biological materials


  • MGNA-C384 (yqjA::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2203 (''[gene|F83EA9CAB8C3AD306F8E70E0DF8C798DC9F6F13B|yqjA]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKE23950 (Δ[gene|F83EA9CAB8C3AD306F8E70E0DF8C798DC9F6F13B|yqjA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGACTCCATTTCTA, downstream forward: _UP4_TGATTCGCATGAGCTCTTCC
  • BKK23950 (Δ[gene|F83EA9CAB8C3AD306F8E70E0DF8C798DC9F6F13B|yqjA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGACTCCATTTCTA, downstream forward: _UP4_TGATTCGCATGAGCTCTTCC