SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


holin, skin element
15.52 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
export of the phage murein hydrolases

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,665,436 → 2,665,858

    The protein

    Protein family

  • Cp-1 holin family (with [protein|4654294F23CBF2D66C72B05ADA9CDC002A30926A|YtkC], according to UniProt)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Biological materials


  • BKE25910 (Δ[gene|F802500099D27794E836C84242BD6CEFB3E06EB7|yqxH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAATCACCTCCTCCG, downstream forward: _UP4_TAAGCCAGTGGCTTTTTTTA
  • BKK25910 (Δ[gene|F802500099D27794E836C84242BD6CEFB3E06EB7|yqxH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAATCACCTCCTCCG, downstream forward: _UP4_TAAGCCAGTGGCTTTTTTTA