SubtiBank SubtiBank
yqxH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqxH

holin, skin element
locus
BSU_25910
pI
8.55
mw
15.52 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
function
export of the phage murein hydrolases
product
holin
essential
no
synonyms
yqdD

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,665,436 → 2,665,858

    The protein

    Protein family

  • Cp-1 holin family (with [protein|4654294F23CBF2D66C72B05ADA9CDC002A30926A|YtkC], according to UniProt)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE25910 (Δ[gene|F802500099D27794E836C84242BD6CEFB3E06EB7|yqxH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAATCACCTCCTCCG, downstream forward: _UP4_TAAGCCAGTGGCTTTTTTTA
  • BKK25910 (Δ[gene|F802500099D27794E836C84242BD6CEFB3E06EB7|yqxH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAATCACCTCCTCCG, downstream forward: _UP4_TAAGCCAGTGGCTTTTTTTA