SubtiBank SubtiBank
scoC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

scoC

transcriptional repressor of genes expressed in the transition phase
locus
BSU09990
pI
5.19
mw
23.57 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
function
transition state regulator
product
transcriptional repressor ([SW|MarR family])
essential
no
synonyms
hpr,catA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,073,106 → 1,073,717

    The protein

    Modification

  • phosphorylated on Arg-3 [Pubmed|22517742]
  • Effectors of protein activity

  • activity is inhibited in an unknown way by [protein|83F1BE86A7AE1098C1319198A8DDA6B8C5F49236|PrkA] (possibly phosphorylation) [Pubmed|25983726]
  • Structure

  • [PDB|2FXA]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000050 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]
    description
    [Pubmed|3131303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19251843], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|2504584], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|69D55899C7CE30A282AF6011527FAD55A76CDBDA|SenS]: positive regulation, in [regulon|69D55899C7CE30A282AF6011527FAD55A76CDBDA|SenS regulon]
  • [protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA]: negative regulation, in [regulon|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: negative regulation, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|2504584]
  • view in new tab

    Biological materials

    Mutant

  • 1A918 ( ''scoC''::''erm trpC2 leuC7''), [Pubmed|15126467], available at the [http://bgsc.org/getdetail.php?bgscid=1A918 Bacillus Genetic Stock Center]
  • BKE09990 (Δ[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
  • BKK09990 (Δ[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • References

    Reviews

  • 28886686
  • Original publications

  • 3131303,16923912,1906467,10383984,16321961,14629015,1907636,15126467,2504584,15104138,19118355,19801406,19898538,20382764,22517742,23660663,11717292,25966844,19251843,26473603,25983726,26728191