SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor of genes expressed in the transition phase
23.57 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
transition state regulator
transcriptional repressor ([SW|MarR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    1,073,106 → 1,073,717

    The protein


  • [SW|HTH marR-type domain] (aa 13-157) (according to UniProt)
  • Modification

  • phosphorylated on Arg-3 [Pubmed|22517742]
  • Effectors of protein activity

  • activity is inhibited in an unknown way by [protein|83F1BE86A7AE1098C1319198A8DDA6B8C5F49236|PrkA] (possibly phosphorylation) [Pubmed|25983726]
  • DNA binding is affected by [protein|D3F00747006D974A8635D4391E0C261A3276E6AB|DnmA]-mediated DNA methylation [pubmed|32324221]
  • Structure

  • [PDB|2FXA]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19251843], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|2504584], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|69D55899C7CE30A282AF6011527FAD55A76CDBDA|SenS]: positive regulation, in [regulon|69D55899C7CE30A282AF6011527FAD55A76CDBDA|SenS regulon]
  • [protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA]: negative regulation, in [regulon|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: negative regulation, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|2504584]
  • view in new tab

    Biological materials


  • 1A918 ( ''scoC''::''erm trpC2 leuC7''), [Pubmed|15126467], available at the [ Bacillus Genetic Stock Center]
  • BKE09990 (Δ[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
  • BKK09990 (Δ[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
  • References


  • 28886686
  • Original publications

  • 3131303,16923912,1906467,10383984,16321961,14629015,1907636,15126467,2504584,15104138,19118355,19801406,19898538,20382764,22517742,23660663,11717292,25966844,19251843,26473603,25983726,26728191,31039790,32324221